An ancient icon reveals new mysteries: mummy DNA resurrects a cryptic species within the Nile crocodile

George Amato

There will be a release of Wiley Online Library scheduled for Saturday 27th November 2010. Access to the website will be disrupted as follows: New York 0630 EDT to 0830 EDT; London 1130 GMT to 1330 GMT; Singapore 1930 SGT to 2130 SGT

Formerly widespread throughout the waterbodies of eastern South Africa, viable Nile crocodile (Crocodylus niloticus) populations are now restricted to three disjunct protected areas in KwaZulu-Natal (KZN), Mpumalanga and Limpopo. Growing evidence suggests that protected populations are declining, including the breeding C. niloticus population at Lake Sibaya in KZN. Aerial surveys were conducted at Lake Sibaya from 2003–2004 and 2007–2009, spotlight counts in 2003 and intensive nesting surveys in 2003 and 2004. Seven adults were counted during the 2009 aerial survey; an 89% decrease from the 1985 count (62 adults) and a decline of 95–98% of the estimated 1970 adult population. Likewise, in 1970 30 nests were recorded, compared to three nests in 2003 and no recorded nests in 2004. The non-hatchling population in 2003 was estimated at 48 individuals and decreased to an estimated eight in 2009. The neighbouring community perceives crocodiles as a threat to their lives and livestock, and...

1. A 12-month-long survey (April 2013 to March 2014) for Nile crocodiles (Crocodylus niloticus) was conducted along a section of the Victoria Nile/Ramsar site of Murchison Falls National Park, in order to update the historic information on crocodile populations in the area, locating nesting areas, determining seasonality patterns and habitat use, and assess the current abundance and the population size trends since the 1960s. The methods employed included visual encounter surveys, transect counts and opportunistic methods, by using boats. 2. In general, there were diurnal and seasonal fluctuations in the number of crocodile sightings. The crocodile sightings peaked between the months of June and August, with the highest mean number of sightings encountered on any single day being 67 (in July 2013), and the second peak was between January and March with the highest mean of 118 recorded in January 2014. The second peak also coincided with the crocodile breeding season. This clearly sh...

Molecular Ecology (2011) doi: 10.1111/j.1365-294X.2011.05245.x FROM THE COVER An ancient icon reveals new mysteries: mummy DNA resurrects a cryptic species within the Nile crocodile E V O N H E K K A L A , * †1 M A T T H E W H . S H I R L E Y , ‡1 G E O R G E A M A T O , † J A M E S D . A U S T I N , ‡ S U E L L E N C H A R T E R , § J O H N T H O R B J A R N A R S O N , ‡– K E N T A . V L I E T , * * M A R L Y S L . H O U C K , § R O B D E S A L L E , † and M I C H A E L J . B L U M †† *Department of Biological Sciences, Fordham University, New York, NY, USA, †Sackler Institute for Comparative Genomics, American Museum of Natural History, New York, NY, USA, ‡Department of Wildlife Ecology & Conservation, University of Florida, Gainesville, FL, USA, §Institute for Conservation Research, San Diego Zoo, San Diego, CA, USA, –Wildlife Conservation Society, New York, NY, USA, **Department of Biological Sciences, University of Florida, Gainesville, FL, USA, ††Department of Ecology & Evolutionary Biology, Tulane University, New Orleans, LA, USA Abstract The Nile crocodile (Crocodylus niloticus) is an ancient icon of both cultural and scientific interest. The species is emblematic of the great civilizations of the Nile River valley and serves as a model for international wildlife conservation. Despite its familiarity, a centuries-long dispute over the taxonomic status of the Nile crocodile remains unresolved. This dispute not only confounds our understanding of the origins and biogeography of the ‘true crocodiles’ of the crown genus Crocodylus, but also complicates conservation and management of this commercially valuable species. We have taken a total evidence approach involving phylogenetic analysis of mitochondrial and nuclear markers, as well as karyotype analysis of chromosome number and structure, to assess the monophyletic status of the Nile crocodile. Samples were collected from throughout Africa, covering all major bioregions. We also utilized specimens from museum collections, including mummified crocodiles from the ancient Egyptian temples at Thebes and the Grottes de Samoun, to reconstruct the genetic profiles of extirpated populations. Our analyses reveal a cryptic evolutionary lineage within the Nile crocodile that elucidates the biogeographic history of the genus and clarifies long-standing arguments over the species’ taxonomic identity and conservation status. An examination of crocodile mummy haplotypes indicates that the cryptic lineage corresponds to an earlier description of C. suchus and suggests that both African Crocodylus lineages historically inhabited the Nile River. Recent survey efforts indicate that C. suchus is declining or extirpated throughout much of its distribution. Without proper recognition of this cryptic species, current sustainable use-based management policies for the Nile crocodile may do more harm than good. Keywords: ancient DNA, African biogeography, Crocodylus, C. niloticus, C. suchus, mummy Received 30 January 2011; revision received 6 July 2011; accepted 7 July 2011 Introduction Correspondence: Evon Hekkala, E-mail: Ehekkala@Fordham.edu We dedicate this work to our co-author, John Thorbjarnarson, who passed during the final preparation of this manuscript and whose unwavering commitment to crocodile conservation has been an inspiration to all of us. 1 Contributed equally as joint first authors. 2011 Blackwell Publishing Ltd The idea that taxonomy is destiny (May 1990) is particularly relevant to the conservation and management of crocodilians (Hutton 2000). Current policies intended to promote sustainable harvest of managed crocodile populations are based predominantly on morphological criteria that provide limited taxonomic and phylogenetic 2 E. HEKKALA ET AL. resolution (Brazaitis 1973; Ross 1998). Assumptions of genetic homogeneity and continuing taxonomic uncertainty within this group raise the concern that management plans may not adequately protect extant diversity and evolutionary potential, especially in more widespread species. This situation is exemplified by the Nile crocodile (Crocodylus niloticus), a widespread, commercially exploited species that has become a model of international wildlife conservation (Ross 1998; Hutton 2000; Fergusson 2010) despite a history of taxonomic discord that has persisted since the eighteenth century (Table 1; Fuchs et al. 1974, King & Burke 1989). The Nile crocodile is comprised of 11 synonymized, historically described species and seven previously proposed subspecies (Table 1). As currently managed, the species is recognized as a single entity, although recent molecular studies provide evidence to the contrary. Limited phylogenetic studies indicate that C. niloticus is paraphyletic (Schmitz et al. 2003; Meredith et al. 2011), and multilocus microsatellite comparisons have shown that populations across Africa are geographically differentiated (Hekkala et al. 2009). Although the Nile crocodile is considered widespread with a largely sub-Saharan distribution, managing this culturally and commercially valuable species as a single, widespread evolutionary lineage may be contributing to a globally significant loss of crocodilian diversity (Hekkala et al. 2009; Shirley et al. 2009). This concern is particularly important in western regions with popula- tions that are increasingly susceptible to range contraction and local extirpation (Shirley et al. 2009). For example, populations were found in the central Sahara until the late nineteenth century (de Smet 1999) though only small isolates may persist in some locales today (Shine et al. 2001). Here we test the hypothesis that the Nile crocodile is a single, homogeneous evolutionary lineage through total evidence molecular analysis of 5016 bp of mitochondrial and nuclear sequence data from samples collected from wild populations across Africa and Madagascar (Fig. 1, Table 2). We provide a complementary temporal perspective spanning over 2 200 years through diagnostic haplotype analysis of historical specimens from museum holdings, including crocodile mummies from the ancient Egyptian sites of Thebes and the Grottes de Samoun. Finally, we compare our sequence-based conclusions with karyotype analysis. Methods Contemporary samples and markers We collected 123 samples of Nile crocodiles from throughout Africa (Fig. 1, Table 2). Collections were made from wild or wild-caught, ranch-held individuals and consisted of tail tissue or fresh blood (<0.5 mL) either in lysis buffer or dried on Whatman filter paper. Table 1 Taxonomic History of the Nile Crocodile. Locality refers to the type locality designation in the literature description, which may not be the same as the origin of the type specimen for that taxon Taxon Author and Year Locality Crocodylus niloticus Synonyms Crocodylus vulgaris Crocodylus suchus Crocodilus multiscutatus Crocodilus marginatus Crocodilus lacunosus Crocodilus complanatus Crocodilus octophractus Alligator cowieii Crocodylus binuensis Crocodilus madagascariensis Crocodilus vulgaris var. madagascariensis Crocodilus hexaphractos Proposed subspecies Crocodylus niloticus niloticus Crocodylus niloticus africanus Crocodylus niloticus chamses Crocodylus niloticus cowiei Crocodylus niloticus madagascariensis Crocodylus niloticus pauciscutatus Crocodylus niloticus suchus Laurenti 1768 Egypt Cüvier 1807 Geoffroy Saint-Hilaire 1807 RÜPPELL in Cretzschmar 1826 GEOFFROY 1827 GEOFFROY 1827 GEOFFROY 1827 RÜPPELL in GRAY in Griffith & Pidgeon 1831 SMITH in Hewitt 1937 Baikie 1857 Grandidier 1872 Boettger 1877 RÜPPELL in SCHMIDT 1886 (nomen nudum) Egypt Nile and Niger Rivers Sudan Egypt Egypt Egypt Sudan South Africa Nigeria Madagascar Madagascar Sudan LAURENTI 1768 LAURENTI 1768 Bory de Saint-Vincent 1824 SMITH in Hewitt 1937 Grandidier 1872 Deraniyagala 1948 Geoffroy Saint-Hilaire 1807 Egypt East Africa Southern Congo South Africa Madagascar Kenya West Africa 2011 Blackwell Publishing Ltd CRYPTIC AFRICAN CROCODYLUS SPECIES REVEALED 3 (a) (b) 16 19 7 1 8 2 13 1 2 14 18 19 9 20 10 21 12 11 3 4 C. niloticus, ancestral 15 3 12 5 6 7 22 34 8 9 13 10 11 17 14 22 23 15 6 18 23 20 24 16 21 25 26 24 27 1 – 250 250 – 500 500 – 1000 1000 – 1500 1500 – 2500 2500 – 3500 3500 – 4500 4500 – 5825 1250 17 5 C. niloticus, derived Rivers Lakes Country boundaries Elevation (meters) 0 4 25 31 32 28 29 26 33 27 30 2500 Kilometers Fig. 1 Map of sample localities showing the distribution of ancestral (white) and derived (red) haplotypes for historical pre-1975 (a) and contemporary post-1975 (b) specimens. To better understand the evolutionary history of C. niloticus in relation to true crocodiles, our analyses included data from samples of seven other Crocodylus species representing both Asian and New World lineages. The remaining members of the Crocodylinae (Osteolaemus tetraspis and Mecistops cataphractus) and Alligator mississippiensis served as outgroups, reflecting the most recent phylogenetic hypotheses for the crown group of the Crocodylidae and the Order Crocodylia (Gatesy & Amato 1992; Brochu 2003; McAliley et al. 2006; Meredith et al. 2011). These taxa were included from samples taken from captive specimens (St. Augustine Alligator Farm, St. Augustine, FL, USA) or previously published sequences available on Genbank as follows: C. rhombifer, C. acutus, C. moreletii, Mecistops cataphractus and Osteolaemus tetraspis (all amplified and sequenced as part of this study), C. intermedius (12s—AY239132, 16s—AY239146, dloop—AF460207, rag1—AY239173), C. porosus (12s—AY770534, 16s— EU621805, dloop—AF460213, WANCY—DQ273698, ND4—AJ810453), C. siamensis (mtDNA—EF581859, rag1—AY136677) (Ray & Densmore 2002; Gatesy et al. 2003). We examined sequence variation across a total of 5 016 bp from nine gene regions. Five regions (2761 bp) were mitochondrial (mtDNA) and four were nuclear (nDNA) (2254 bp), as follows: control region ⁄ dloop (735 bp); 12s rRNA (421 bp); 16s rRNA (415 bp); WANCY tRNA cluster (Seutin et al. 1994) from the ND2flanking region including tRNA_Trp, tRNA_Ala, tRNA_Asn, tRNA_Cys, and part of tRNA_Tyr (330 bp); NADH dehydrogenase 4 (ND4, 860 bp); recombination 2011 Blackwell Publishing Ltd activating gene 1 (rag1, 469 bp); ribosomal protein S6 (693 bp); and introns for tropomyosin (330 bp) and ornithine decarboxylase (762 bp) (Friesen et al. 1999). Contemporary sample data collection DNA was extracted using Qiagen Easy-DNA extraction kits or standard phenol–chloroform methods. Extraction products were stored at 50 ng ⁄ lL. PCR cocktails and cycling conditions were optimized for each marker (Table S1, Supporting information) and amplifications were performed on an ABI 9700 thermocycler in 20– 25 lL volumes. Sanger sequencing reactions were carried out using BigDye v3.1 sequencing kits in 6–8 lL volumes. Gene regions were sequenced in both directions on either an ABI 3700 or 3730XL automated capillary sequencer. Base calling was performed with Sequencher v4.1 (Genecodes Corp.). Consensus sequences were produced with CLC v3.6.2. Marker datasets were compiled and aligned individually in MEGA4 (Tamura et al. 2007) utilizing Clustal W (Larkin et al. 2007) (Gap penalties = 50, Gap Extension penalties = 25) and checked by eye prior to concatenation. Contemporary sample analyses Sequence data were first analyzed for fixed characters using Population Aggregation Analysis (Davis & Nixon 1992) and terminal taxa with unique and fixed characters were subsequently examined for phylogenetic structure with data from all species combined by genome and concatenated for total evidence analysis (Maddison 1997; Map Number Terminal Label Year Collected 2011 Blackwell Publishing Ltd Museum Specimen# 1825–1829 MNHN 1977_1606 1934 approx. 1824 1885 1886 FMNH MNHN MNHN MNHN 20798 2175 1885407 1886_182 1882 1924 MNHN AMNH 1886_186 28904 Cailloud 700–2200 YBP MNHN 1986_1471 brought from Egypt 1820’s Cailloud 700–2200 YBP MNHN 1986_1473 brought from Egypt 1820’s Cailloud 700–2200 YBP MNHN 1986_1479 brought from Egypt 1820’s V. Schoelcher Gervais 700–2200 YBP 700–2200 YBP MNHN MNHN 1886_445 1986_1475 Gervais 700–2200 YBP MNHN 1986_1478 Pariset 700–2200 YBP MNHN 1986_1480 1927 1922 1922 1911 AMNH AMNH AMNH AMNH 42962 23464 23465 10079 1803–1827 1749–1754 1966 approx. 1822 MNHN MNHN CAS MNHN 7364 7524 133814 7546 Country Locality Collector Figure 1A* 1 SENEGAL_1825 Senegal UNK 2 3 4 5 SENEGAL_1934 SENEGAL_1824 IVORY COAST_1885 REP CONGO_1882 Senegal Senegal Cote-d’Ivoire Republic of Congo Kedougou(a) UNK Assinie N’ganchou G.S. Perrottet & F.M.R. Leprieur F.C. Wonder Brongniart Chaper P.S. de Brazza 5 6 REP CONGO_1886 DEM REP CONGO_1924 N’gouchou Kasai River P.S. de Brazza Father R. Callewaert 7 MUMMY_THEBES_A Republic of Congo Dem. Republic of Congo Egypt 7 MUMMY_THEBES_B Egypt 7 MUMMY_THEBES_C Egypt 7 8 MUMMY_HAUTE MUMMY_SAMOUN_A Egypt Egypt 8 MUMMY_SAMOUN_B Egypt 8 MUMMY_SAMOUN_C Egypt 9 10 11 12 SUDAN_MELUT_1922 SUDAN_WNA_1922 SUDAN_WNB_1922 ZIMBABWE_1911 Sudan Sudan Sudan Zimbabwe Mummy - Grottes de Thebes Mummy - Grottes de Thebes Mummy - Grottes de Thebes Mummy, Haute Egypt Mummy - Grottes de Samoun Mummy - Grottes de Samoun Mummy - Grottes de Samoun Melut White Nile White Nile Faradje 13 14 15 16 SENEGAL_1803 SENEGAL_1768 CAMEROON_1966 EGYPT_1822 Senegal Senegal Cameroon Egypt UNK UNK Edea, Sanaga River Nile Anthony Taylor Taylor Lang - Chapin Expedition C. Heudelot Adanson T.J. Papenfuss T. Duvant Notes Not included in analysis, partial sequence identical to REP CONGO_1886 Crocodylus vert TYPE Crocodylus vulgaris PARATYPE 4 E. HEKKALA ET AL. Table 2 Contemporary and Historical Samples Utilized in This Study. Locality and sampling data for each specimen utilized in this study. For archival material, both the original collection locality and the museum accession information are listed. Terminal Label refers to the specimen ID given in Fig. 2, Figs S1 and S2, Table 3, and Table S3. Museum acronyms: AMNH—American Museum of Natural History (New York, NY, USA), CAS—California Academy of Sciences (San Francisco, CA, USA), FLMNH—Florida Museum of Natural History (Gainesville, FL, USA), MNHN—Museum Nationale d’Histoire Naturelle (Paris, France), USNM—National Museum of Natural History, Smithsonian Institution, Washington, DC, ZFKM—Alexander Koenig Zoological Research Museum, Bonn, Germany). Genbank accession numbers are listed next to individuals from Schmitz et al. 2003. * Indicates only short 12s and ⁄ or dloop fragments were sequenced 2011 Blackwell Publishing Ltd Table 2 (Continued) Map Number Terminal Label Country Locality Collector 17 ZIMBABWE_1912 Zimbabwe Faradje 18 19 20 21 22 23 24 25 26 SUDAN_UN_1922 SUDAN_WNC_1922 SUDAN_WND_1922 SUDAN_WNE_1922 KENYA_1960 KENYA_1919 TANZANIA_1972 BOTSWANA_1967 MADAGASCAR_1885 Sudan Sudan Sudan Sudan Kenya Kenya Tanzania Botswana Madagascar Zeraf, Upper Nile White Nile White Nile White Nile Garissa Nairobi UNK Shakawe Tulear Lang - Chapin Expedition Taylor Taylor Taylor Taylor R.H. Pine H.C. Raven USFWS Confiscation T. Liversedge A. Grandidier Year Collected Museum Specimen# 1912 AMNH 10081 1922 1922 1922 1922 1960 1919–1920 1972 1967 1870 AMNH AMNH AMNH AMNH AMNH USNM AMNH USNM MNHN 23471 23466 23469 23470 88634 63592 108941 195448 6498 Madagascar Madagascar Madagascar Amboasary Amboasary Amboasary H. Bluntschli H. Bluntschli H. Bluntschli 1931 1931 1931 AMNH AMNH AMNH 71192 142496 71191 Mauritania Matmata S. Robin 1993 MNHN 1993_5805* 2 MAURITANIA_2 Mauritania Aioun el-Atrouss Bohme UNK ZFMK Uncatalogued 3 SENEGAL Senegal Casamance River M.H. Shirley 2008 FLMNH Uncatalogued 4 GAMBIA_1 The Gambia W. Bohme UNK N⁄A 4 4 5 6 GAMBIA_2 GAMBIA_3 BURKINA FASO IVORY COAST_1 The Gambia The Gambia Burkina Faso Cote-d’Ivoire Kedougou, Gambia River River Gambia NP River Gambia NP UNK Abi Lagoon M.H. Shirley M.H. Shirley Bohme M.H. Shirley 2008 2008 UNK 2006 FLMNH FLMNH N⁄A FLMNH Uncatalogued Uncatalogued 7 8 9 IVORY COAST_2 GHANA_1 GHANA_2 Cote-d’Ivoire Ghana Ghana Go River Mole National Park Legon Farms Dam, Accra M.H. Shirley M.H. Shirley M.H. Shirley 2006 2006 2006 FLMNH FLMNH FLMNH Uncatalogued Uncatalogued Uncatalogued 10 11 BENIN* NIGERIA Benin Nigeria R. Bourgat M.P.O. Dore 1978 2009 MNHN FLMNH 1978_2051 Uncatalogued 12 CHAD Chad UNK Escravos River, Niger Delta Ennedi M. Klemens 1997 AMNH 145361* Uncatalogued Crocodylus madagascariensis TYPE Short 12S and dloop sequences only From 4 specimens utilized in Schmitz et al. 2003 Djibelor Crocodile Farm wild stock Specimen utilized in Schmitz et al. 2003 Not included in phylogenetic analysis, same as haplotype found at Site 7 Not included in phylogenetic analysis, same as haplotype found at Site 8 Bushmeat sample collected in Benin City Short 12S and dloop sequences only CRYPTIC AFRICAN CROCODYLUS SPECIES REVEALED 5 27 MADAGASCAR_A_1931 27 MADAGASCAR_B_1931 27 MADAGASCAR_C_1931 Figure 1B 1 MAURITANIA_1 Notes 2011 Blackwell Publishing Ltd Map Number Terminal Label Country Locality Collector Year Collected Museum Specimen# Notes 13 CENTRAL AFR REP Berberati, near Bangui L. Chirio 1995 MNHN 1997_3171* MNHN 1997_3171, Short 12S and dloop sequences only 14 14 14 15 16 REP CONGO_1* REP CONGO_2* REP CONGO_3* REP CONGO_4 DEM REP CONGO Dougou, Oubangi River Likouala (Edzala?) Lukouala, Congo Likouala aux Herbes Lac Mai Ndombe V. de Buffrenil V. de Buffrenil V. de Buffrenil M.J. Eaton R. Fergusson 1986 1986 1986 2004 2002 MNHN MNHN MNHN FLMNH N⁄A 1987_1120 1987_1114 1986_1945 Uncatalogued 17 17 18 18 19 19 19 19 19 UGANDA_1 UGANDA_2 GABON_1 GABON_2 EGYPT_1 EGYPT_2 EGYPT_3 EGYPT_4 EGYPT_5 Central African Republic Republic of Congo Republic of Congo Republic of Congo Republic of Congo Dem. Republic of Congo Uganda Uganda Gabon Gabon Egypt Egypt Egypt Egypt Egypt Kidepo Valley NP Kidepo Valley NP Petit Loango, Loango NP Petit Loango, Loango NP Lake Nasser, near Aswan Lake Nasser, near Aswan Lake Nasser, near Aswan Lake Nasser, near Aswan Lake Nasser M.H. Shirley M.H. Shirley M.J. Eaton M.J. Eaton M.H. Shirley M.H. Shirley M.H. Shirley M.H. Shirley UNK 2009 2009 2006 2006 2008 2008 2008 2008 UNK FLMNH FLMNH FLMNH FLMNH FLMNH FLMNH FLMNH FLMNH ZFMK Uncatalogued Uncatalogued Uncatalogued Uncatalogued Uncatalogued Uncatalogued Uncatalogued Uncatalogued Uncatalogued 20 21 21 22 KENYA_1 KENYA_2 KENYA_3 UGANDA_3 Kenya Kenya Kenya Uganda R. Fergusson R. Fergusson R. Fergusson M.H. Shirley 2001 2001 2001 2010 N⁄A N⁄A N⁄A FLMNH Uncatalogued 22 23 UGANDA_4 UGANDA_5 Uganda Uganda M.H. Shirley M.H. Shirley 2010 2010 FLMNH FLMNH Uncatalogued Uncatalogued 24 UGANDA_6 Uganda M.H. Shirley 2010 FLMNH Uncatalogued 25 26 27 28 TANZANIA_2 TANZANIA_1 MALAWI ZIMBABWE_1 Tanzania Tanzania Malawi Zimbabwe Tana River Tana River Tana River Victoria Nile, Murchison Falls NP Semliki River, Semuliki NP Lake Edward, Queen Elizabeth NP Lake Mburo, Ruizi Drainage, Lake Mburo NP Lake Rukwa Rufiji River Salima Bay Lake Kariba R. Fergusson R. Fergusson R. Fergusson UNK 2001 2001 2001 UNK N⁄A N⁄A N⁄A N⁄A 28 ZIMBABWE_2 Zimbabwe Lake Kariba UNK UNK N⁄A 29 30 31 31 32 33 34 ZIMBABWE_3 SOUTH AFRICA MADAGASCAR_1 MADAGASCAR_2 MADAGASCAR_3 MADAGASCAR_4 SUDAN Zimbabwe South Africa Madagascar Madagascar Madagascar Madagascar Sudan Lake Kariba Lake St. Lucia Ankarana Caves Ankarana Caves Betsiboka River Estuary, Fort Dauphin Chor Melk en-Nasir R. Fergusson A. Leslie Garcia Garcia E. Hekkala de Huelme UNK 2002 UNK 2002 2002 2000 2002 UNK N⁄A N⁄A N⁄A N⁄A N⁄A N⁄A ZFMK Bushmeat sample collected in Inongo 12s sequence from Schmitz et al. 2003 (AY195943) 12s et 12s et 50489 sequence from Schmitz al. 2003 (AY 195954 ⁄ 55) sequence from Schmitz al. 2003 (AY 195954 ⁄ 55) 12s sequence from Schmitz et al. 2003 (AY195953) 6 E. HEKKALA ET AL. Table 2 (Continued) CRYPTIC AFRICAN CROCODYLUS SPECIES REVEALED 7 Kluge 1998). Prior to analysis, individual marker datasets were tested for the maximum likelihood model of evolution with jModelTest 0.1.1 (Posada 2008) and MrModelTest2.3 (Nylander et al. 2004) for a C. niloticus-only dataset and a dataset including Crocodylus outgroups. Where the inferred model of evolution was not consistent between datasets, we chose the model selected for the C. niloticus-only data. Datasets were tested for congruence and analyzed in PhyML (Guindon & Gascuel 2003) and MrBayes (Ronquist & Huelsenbeck 2003) to generate hypotheses of phylogenetic structure under maximum likelihood and Bayesian algorithms as follows: Maximum likelihood. A PhyML search was implemented on the Montpellier Bioinformatics Platform (http:// www.atgc-montpellier.fr/phyml). The full, concatenated dataset was analyzed under HKY85+I+G substitution model as per the recommendation of jModelTest 0.1.1. Trees were searched from a starting tree created by BIONJ using the best of the SPR and NNI options with topologies and branch lengths optimized. Branch support was determined with both the SH-Like and Chi2based options of the Approximate Likelihood Ratio Test (aLRT) method (Anisimova & Gascuel 2006), as well as nonparametric bootstrapping over 100 replicates. To test the hypothesis of C. niloticus monophyly, we compared the resulting topology to a constrained tree compiled in MacClade4.01 (Maddison 1997) wherein C. niloticus represented a monophyletic group. Additional ML searches were conducted and the likelihood values for the constrained and unconstrained topologies were compared using the Shimoduro–Hasegawa option in PAUP4.0b10 (Swofford 2002). Statistical measures for rejection of the hypothesis of no difference were set at 95%. Bayesian inference. The concatenated dataset was partitioned by gene region with the substitution model implemented for each gene (12s—HKY+I, 16s—GTR+G, dloop—HKY+I, ND4—GTR+G, WANCY—HKY, rag1—JC, OD—F81, TROP—F81, S6—F81, mtDNA—HKY+I+G, nDNA—HKY+I) where all model parameters were estimated by MrModelTest2.3 (Nylander et al. 2004). Gaps (indels) were coded as restriction site binary characters. Three simultaneous Markov Chain Monte Carlo searches were run with five chains for 12 000 000 generations with trees sampled every 500 generations. A 50% majority rule consensus tree was created after discarding the first 2000 ‘burn-in’ trees. Trees were rooted by both outgroup and mid-point rooting methods; both methods produced the same root point (Hess et al. 2007). We used BEAST v1.5beta2 (Drummond et al. 2006), which implements a Bayesian MCMC method and a 2011 Blackwell Publishing Ltd relaxed molecular clock approach (Drummond 2007), to estimate divergence times. We assumed a relaxed lognormal model of lineage variation and a Yule prior for branching rates. We examined rates using the combined dataset (nuDNA and mtDNA) partitioned by gene region, as well as by coding versus non-coding regions. The coding regions were further partitioned according to 1 + 2 and 3 codon positions and the substitution model, rate heterogeneity and base frequencies were unlinked across codon positions [(1 + 2), 3]. For calibration, we used fossil record-based estimates of the divergence between Alligator and Crocodylus (ca. 79 mya), Crocodylus and Mecistops ⁄ Osteolaemus (at ca. 20–24 mya), as well as the earliest fossil appearances of C. niloticus in Africa (ca. 3–7 mya) (Brochu 2004c; Brochu personal communication), and Crocodylus in the Caribbean (conservatively estimated at 4–5 mya; Miller 1980). We used these dates as lognormal distribution priors for each respective node setting the offset as the minimum age (A. Drummond personal communication). We placed monophyly constraints on the New World clade and on eastern C. niloticus, respectively, thus attaining the same general topology as assessed by the full phylogenetic analyses. Three replicates were run for 100 000 000 generations each with tree and parameter sampling occurring every 1000 generations. The adequacy of a 10% burn in and convergence of all parameters were assessed using the software TRACER v1.4.1 (Rambaut & Drummond 2005). The sampling distributions of the three independent replicates were then combined using the software LogCombiner v1.5 and the resulting 360 000 000 samples summarized and visualized using the software Tree Annotator v1.5 and FigTree v1.2 (Rambaut 2006). Mean intra- and inter-clade distances (i.e. number of base substitutions per site from averaging over all sequence pairs within and between groups) were calculated in MEGA4 for both the combined and the mtDNA only datasets (Tamura et al. 2007). Sequences for captive individuals were removed from all analyses, and divergence estimates for pairs not including Alligator were estimated with the preceding datasets minus Alligator. Analyses were conducted using Maximum Composite Likelihood (Tamura et al. 2004). The rate variation among sites was modeled with a gamma distribution (shape parameter = 1). The differences in the composition bias among sequences were considered in evolutionary comparisons (Tamura & Kumar 2002). Codon positions included were 1st+2nd+3rd+Noncoding. All ambiguous positions were removed for each sequence pair. Standard error estimates were obtained by bootstrapping over 500 replicates. 8 E. HEKKALA ET AL. Ancient DNA methods Tissue was harvested from 57 dried or ethanol preserved museum specimens from eight institutions, including both natural history and anthroplogical collections (Table 2). We sampled Egyptian crocodile mummies from the Phoebe Hearst Museum (PHM) at the University of California, Berkley; the University of Pennsylvania Museum of Anthroplogy (UPenn); the British Museum (BM); and the Musée National d’Histoire Naturelle (MNHN) (Table S3, Supporting information). During all archival tissue collections, surgical utensils were sterilized and work areas were wiped with DNAaway (Molecular Bioproducts) between samples. Specimen surfaces were wiped with 20% Clorox bleach and air dried prior to sampling. Mummified crocodile hatchlings from MNHN, PHM and UPenn were very fragile and handled separately. Individuals from MNHN were originally collected from two sealed tombs (Grotte de Samoun and Grotte de Thebes) in the early 1800s and are estimated to have been interred between 200 BC and 200 AD (S. Ikram, Cairo Museum, personal communication.). One hatchling from PHM was from collections noted as ‘predynastic’ Egypt (estimated ‡3100 BC), while one from Upenn was undated. For each hatchling a cross section of the tail, including bone and muscle tissue, was sampled, rinsed with 20% Clorox bleach and sterile water prior to hydration in glycine buffer for 1 week to 3 months with regular fluid changes (Shedlock et al. 1997). Samples from adult mummies and more recent specimens (nineteenth and twentieth centuries), were soaked for 36–76 h in PBS with multiple fluid changes. All museum samples were processed in clean room facilities, separate from contemporary samples. Processing of each specimen was replicated in at least one additional institution [either American Museum of Natural History aDNA Laboratory (AMNH), University of Nevada Reno (UNR), U.S. EPA aDNA Laboratory, Cincinnati, OH (EPA), or Tulane University (TU)]. At each institution DNA extraction, PCR setup and post-PCR handling of archival samples took place in physically separate locations with procedures following precautionary protocols recommended for use with degraded or ancient DNA (Cooper & Poinar 2000; Paabo et al. 2004; Gilbert et al. 2005; Willerslev & Cooper 2005). Facilities at AMNH and EPA were equipped with positive air pressure, wall mounted UV lamps, protective disposable lab attire, and direct shipping of all equipment and reagents, while those at TU and UNR consisted of separate, dedicated lab space. DNA extraction from archival museum specimens consisted of a modified Qiagen DNeasy tissue protocol after extended hydration in either PBS or Glycine buf- fer. All samples were handled in batches of 6 with the exception of mummies, which were processed as batches ‘per institution’ of 4–8 samples. Negative controls were included throughout the process for each batch of samples. During tissue digestion, 5 lL of 1 M dithiothreitol (DTT) was added along with proteinase K to enhance protein digestion. Care was taken to mix reagents by hand at each step rather than risk shearing the DNA by vortexing. Samples were eluted in two separate volumes of 75 lL with elution buffer warmed to 56 C after resting in the column for 15 min. All pre- and post PCR handling was physically separated, and involved use of both positive and negative controls. Positive PCR controls were added after archival tubes were sealed and placed on the thermocycler. Primers were designed from modern crocodile sequences to amplify ±187–200 bp each of mitochondrial 12s rRNA and d-loop gene regions covering previously identified hypervariable sites (12s183 5¢TTGCCCT AAGCAGCCTGTAT3¢, 12s375 5¢CCGTCTTTGACAGTC CTGGT3¢; and ncdlpFs 5¢GCCGACATTCTTATTAAACTAC3¢, ncdlpRs 5¢GCAGATAAATGAATGCCTTAT3¢, Table S1). In addition, we attempted to amplify a 600 bp gene region using crocodile specific 12s primers to confirm that no contemporary DNA was present in aDNA extracts (Paabo et al. 2004). Template DNA was amplified using GE Illustra puretaq PCR beads in 25 lL volumes and amplification products were visualized on a 1% agarose gel with EtBr staining. Successfully amplified PCR products were cleaned using ExoSAP-IT (Affymetrix). Sanger sequencing reactions were carried out using BigDye v3.1 sequencing kits in 6–8 lL volumes. Gene regions were sequenced in both directions on either an ABI 3100, 3700 or 3730XL automated capillary sequencer. Base calling was performed with Sequencher v4.1 (Genecodes Corp.). In case of sequence ambiguity, archival tissue samples were re-extracted, amplified and sequenced up to three times for verification (Paabo et al. 2004). Historical specimen sequence analyses Both 12s and d-loop sequences from archival specimens were individually aligned with sequences from contemporary specimens. Assignment of each archival specimen to an evolutionary lineage was based on diagnostic characters found in sequences from contemporary specimens. Nucleotide sites were considered diagnostic if they were variable with fixed base differences between clades. We utilized a PAA (Davis & Nixon 1992) approach to assign historical specimens to clades with the program CAOS (Character Attribute Organization System; Sarkar et al. 2009). 2011 Blackwell Publishing Ltd CRYPTIC AFRICAN CROCODYLUS SPECIES REVEALED 9 As an exploratory measure, we performed a phylogenetic analysis of the aligned short fragment sequence data using a maximum likelihood approach as implemented in PhyML with the substitution model implemented HKY+I, as previously estimated by jModelTest 0.1.1 (Posada 2008). Karyotyping Samples for karyotype analysis were collected from Nile crocodiles at the St. Augustine Alligator Farm Zoological Park and had the following accession numbers: SAAF_1—93220, SAAF_edpool—A01026, and SAAF_ 2—93044. Karyotyping was conducted on four cell lines. Skin biopsies were taken from the toe webbing of captive individuals and primary fibroblast cell lines were established and preserved in the San Diego Zoo’s Frozen Zoo cell repository. Harvests and chromosome banding followed Kumamoto et al. (1996) with the exception of a 33 C cell culture incubation temperature. We also obtained DNA sequence data from these indi- viduals, following the protocols for contemporary specimens presented above, for comparison to natural populations and to address concerns about potential hybridization in captivity. Results All phylogenetic methods used to examine our combined mtDNA and nDNA sequence dataset recovered a paraphyletic C. niloticus, with a predominantly western African clade sister to a monophyletic clade comprised of a predominantly eastern African C. niloticus plus the four New World Crocodylus species (Fig. 2). Tree topologies with significantly weaker support values were recovered when C. niloticus monophyly was imposed. Mean, corrected sequence divergence estimates showed little intraclade divergence (<0.3%) for both the total, concatenated dataset and the mtDNA dataset in both C. niloticus clades (Table S2, Supporting information). Mean intraclade divergence estimates between the eastern and western clades did not overlap with mean REP CONGO_4 UGANDA_1 GAMBIA_2 GAMBIA_3 SENEGAL GAMBIA_1 MAURITANIA_2 BURKINA FASO IVORY COAST_2 GHANA_1 DEM REP CONGO SAAF_1 UGANDA_2 NIGERIA C. rhombifer C. moreletii C. acutus C. intermedius EGYPT_1 EGYPT_2 EGYPT_3 EGYPT_4 SAAF_2 GABON_1 UGANDA_6 UGANDA_5 UGANDA_3 KENYA_1 KENYA_2 KENYA_3 SOUTH AFRICA MALAWI ZIMBABWE_3 TANZANIA_1 TANZANIA_2 MADAGASCAR_1 MADAGASCAR_2 MADAGASCAR_3 MADAGASCAR_4 C. siamensis C. porosus O.tetraspis M. cataphractus A. mississippiensis Fig. 2 Phylogenetic tree illustrating results of the Bayesian analysis of the full dataset, with karyotype insets. As illustrated, both the phylogenetic and karyotype analyses support a paraphyletic C. niloticus with the predominantly western clade (light grey) as sister to a monophyletic New World and Eastern C. niloticus clade. Posterior Probabilities (PP) are indicated above branches. Significant support is indicated by PP > 0.90. Individuals SAAF_1, SAAF_P (western) and SAAF_2 (eastern) exhibit the karyotypes displayed in the insets. Both BY and ML analyses resulted in similar tree topologies. 2011 Blackwell Publishing Ltd 10 E . H E K K A L A E T A L . interclade divergence values, which were more than an order of magnitude higher (>4%), for both the total concatenated dataset and the mtDNA dataset (Table S2). Karyotyping of representative captive individuals from each clade affirmed sequence-based evidence of evolutionary divergence between the two C. niloticus lineages (Fig. 2, inset). Consistent with prior findings, the derived eastern C. niloticus clade exhibits 32 chromosomes, comprised of 26 metacentric-submetacentric and six acrocentric elements. The ancestral western C. niloticus clade exhibits 34 chromosomes consisting of 24 metacentric–submetacentric and 10 acrocentric elements. Divergence time estimates from the BEAST analyses of the full dataset partitioned by gene and partitioned by coding region and codon position were similar (i.e. the mean estimated dates from one analysis fell within the 95% confidence intervals of the other analysis), though mean ages were generally older and the confidence intervals were larger when the data were partitioned by gene region. Hence, we report only the outcome of the analysis based on coding region and codon position. Divergence time estimates suggest that the western C. niloticus lineage last shared a common ancestor with the New World-Eastern C. niloticus clade approximately 8.13 mya (5.24–12.64 mya, 95% CI tmrca) (Fig. S1, Supporting information). The western clade was estimated to have arisen ca. 2.455 mya (0.903– 4.722 mya, 95% CI tmrca) (Fig. S1). The eastern C. niloticus lineage was estimated to have last shared a common ancestor with the New World clade approximately 5.7 mya (3.69–8.44 mya, 95% CI tmrca) (Fig. S1). We sequenced up to 197 bp of the 12s rRNA and up to 219 bp of the dloop from mtDNA regions for 40 of 57 museum specimens (Table 2). We were able to obtain sequence data for 8 of 22 crocodile mummies. Only the mummified hatchlings from MNHN yielded DNA (Table S3). Our attempts to amplify the larger 12s fragment in the mummy and other museum specimens failed, indicating that there was no contamination with contemporary crocodile DNA. An alignment of the short 12s and d-loop sequences from contemporary specimens found 11 and 14 diagnostic sites, respectively, for the two C. niloticus clades (Table 3). Comparison of sequences obtained from the historical specimens to these diagnostic sites enabled us to assign 24 individuals, including all 8 mummy sequences, to the western clade and 16 individuals to the eastern clade (Fig. 1, Table 3). Phylogenetic analysis of the short aDNA dataset recovered a western clade including all mummies and placement of all other museum specimens consistent with the haplotype based clade assignment (Fig. S2, Supporting information). Haplotype assignments of mummy specimens and well documented collections from the Sudanese Nile valley indicate that the two lineages of C. niloticus have had overlapping distributions in the Nile drainage for nearly two millennia (Fig. 1b, Table 3). In addition, derived eastern haplotypes were recovered from two historical specimens from coastal Senegal. Contemporary distributions suggest that little geographical overlap now occurs (Fig. 1a). For example, all contemporary Egyptian specimens possess derived haplotypes, whereas no derived eastern haplotypes have been found in contemporary populations thus far sampled in West Africa. Discussion Our total evidence based phylogenetic analysis revealed a cryptic evolutionary lineage within the Nile crocodile. This finding not only clarifies recent and historic disputes regarding both C. niloticus’ taxonomy and the biogeographic history of the genus, but also stands to improve conservation and management of crocodilian diversity across Africa and elsewhere. Crocodylus diversity and taxonomy Extant crocodiles are often portrayed as ‘living fossils,’ reflecting perceptions of morphological homogeneity and evolutionary stasis, but evidence of greater crocodilian diversity and evolutionary dynamism is beginning to emerge. Eaton et al. (2009), for example, has found cryptic diversity within the African dwarf crocodiles of the genus Osteolaemus. Our results also indicate that greater diversity occurs within the crown genus Crocodylus than is currently recognized. Recognition of subspecies (e.g. Fuchs et al. 1974) does not adequately reflect the degree or nature of divergence between the two recovered C. niloticus clades. Our findings show that the two C. niloticus lineages are distant relatives, and their paraphyletic relationship relative to New World congeners indicates that the two C. niloticus clades are not sister taxa. Additionally, fixed differences across sequence-based marker sets and chromosomes, as well as interclade distances, offer a basis for diagnosing the two C. niloticus lineages as distinct species (Moritz 1994; Goldstein & DeSalle 2000). Although molecular divergence estimates between members of the genus Crocodylus vary by clade and marker, recognized Crocodylus species generally exhibit <1% intraspecies divergence and 2.5–7.5% interspecies divergence (White & Densmore 2001; McAliley et al. 2006). Similarly, newly diagnosed species within the genus Osteolaemus exhibit within-clade divergence of <0.4% and between-clade divergences of 4–16%, 2011 Blackwell Publishing Ltd C R Y P T I C A F R I C A N C R O C O D Y L U S S P E C I E S R E V E A L E D 11 Table 3 Population Aggregation Analysis (PAA) Assigning Archival Specimens to Western or Eastern Clade. Diagnostic nucleotide positions within the short 12s (11 sites) and d-loop (14 sites) sequences. Specimens in bold represent archival material. Eight mummy specimens are highlighted in grey, all correspond to the western lineage. Sequences with question marks across one marker represent failed amplification success for that specimen. D-loop site 206 is an indel event in the eastern clade. The miscoding error observed at d-loop site 226 due to DNA degradation Gene region position 12s dloop 187 193 204 206 209 221 225 229 258 274 303 121 122 128 147 156 201 203 206 209 223 226 227 234 240 Western Consensus A G A C C A C A T C G A T T C A T A A A T C T C T SAAFedpool BURKINAFAS DRCONGO GHANA GAMBIA GAMBIAA GAMBIAB IVORYCOAST MAURITANIA NIGERIA SENEGAL RCONGO KARAMOJAA KARAMOJAB MummyHaute MummySamA MummySamB MummySamC MummySamD MummyThebA mummyThebB mummyThebC Benin1990 SanghaCAR Chad1993 DRCEdz1986 DRCLukuelu DRCKas1924 CIAssi1885 RCNgou1886 Matmat1993 DRCNE1911 Oubang1986 Senega1824 Senega1825 SudMel1922 SudWNA1922 SudWNB1922 Senaga1934 Eastern Consensus . . . . . . . . . . . . . . . . ? ? ? ? . . . . . . . . . . . . ? ? . . . . . T . . . . . . . . . . . . . . . . ? ? ? ? . . . . . . . . . . . . ? ? . . . . . A . . . . . . . . . . . . . . . . ? ? ? ? . . . . . . . . . . . . ? ? . . . . . G . . . . . . . . . . . . . . . . ? ? ? ? . . . . . . . . . . . . ? ? . . . . . A . . . . . . . . . . . . . . . . ? ? ? ? . . . . . . . . . . . . ? ? . . . . . T . . . . . . . . . . . . . . . . ? ? ? ? . . . . . . . . . . . . ? ? . . . . . T . . . . . . . . . . . . . . . . ? ? ? ? . . . . . . . . . . . . ? ? . . . . . T . . . . . . . . . . . . . . . . ? ? ? ? . . . . . . . . . . . . ? ? . . . . . G . . . . . . . . . . . . . . . . ? ? ? ? . . . . . . . . . . . . ? ? . . . . . A . . . . . . . . . . . . . . . . ? ? ? ? . . . . . . . . . . . . ? ? . . . . . T . . . . . . . . . . . . . . . . ? ? ? ? . . . . . . . . . . . . ? ? . . . . . A . . ? . . . . . . . . ? . . . . . . . . . . ? . ? . . ? ? . . . . . . ? ? ? ? G . . ? . . . . . . . . ? . . . . . . . . . . ? . ? . . ? ? . . . . . . ? ? ? ? C . . ? . . . . . . . . ? . . . . . . . . . . ? . ? . . ? ? . . . . . . ? ? ? ? C . . ? . . . . . . . . . . . . . . . . . . . ? . ? . . ? ? . . . . . . ? ? ? ? . . . ? . . . . . . . . . . . . . . . . . . . ? . ? . . ? ? . . . . . . ? ? ? ? G . . ? . . . . . . . . . . . . . . . . . . . ? . ? . . ? ? . . . . . . ? ? ? ? A . . ? . . . . . . . . . . . . . . . . . . . ? . ? . . ? ? . . . . . . ? ? ? ? G – – ? – – – – – – – – . – – – – – – – – – – ? – ? – – ? ? – – – – – – ? ? ? ? C . . ? . . . . . . . . . . . . . . . . . . . ? . ? . . ? ? . . . . . . ? ? ? ? G . . . . . . . . . . . C . . C C C C C C C C ? C ? C . ? ? C . C . . . ? ? ? ? G . . . . . . . . . . . . . . . . T . . T . . ? . ? . . ? ? . . . . . . ? ? ? ? . . . . . . . . . . . . . . . . . . . . . . . ? . ? . . ? ? . . . . . . ? ? ? ? C . . . . . . . . . . . . . . . . . . . . . . ? . ? . . ? ? . . . . . . ? ? ? ? T . . . . . . . . . . . . . . . . . . . . . . ? . ? . . ? ? . . . . . . ? ? ? ? C T T T T T T T T A A A A A A A A G G G G G G G G A A A A A A A A T T T T T T T T T T T T T T T T T T T T T T T T G G G G G G G G A A A A A A A A T T T T T T T T A A A A A A A A G G G G G G G G C C C C C C C C C C C C C C C C . . . . . . . . G G G G G G G G A A A A A A A A G G G G G G G G C C C C C C C C G G G G G G . . G G G G G G G G . . . . . . . . C C C C C C C C T T T T T T T T C C C C C C C C SAAF2 GABONa NASSERA NASSERB NASSERC NASSERD MADAGASCNW MADAGASCSE 2011 Blackwell Publishing Ltd 12 E . H E K K A L A E T A L . Table 3 (Continued) Gene region position Eastern MADAGASCAA MADAGASCAB SAFRICA KENYAA KENYAB KENYAC QUEENNP02 MURCHISON2 LAKEMBURO2 ZIMBABWE TANZANIAA TANZANIAB MALAWI Sudan Nasser Kariba1 Kariba2 DRCNE1912 Botswa1967 SWCam1966 KenGar1960 KenNai1919 MadAmA1931 MadAmB1931 MadAMC1931 madTYP1885 vulTYP1822 VerTYP1768 Senega1803 SudWNC1922 SudWND1922 SunWNE1922 SudUN1922 Tanz1972 12s dloop 187 193 204 206 209 221 225 229 258 274 303 121 122 128 147 156 201 203 206 209 223 226 227 234 240 T T T T T T ? ? ? T T T T T T T T T ? T T ? T T ? T T T T T T T T T A A A A A A ? ? ? A A A A A A A A A ? A A ? A A ? A A A A A A A A A G G G G G G ? ? ? G G G G G G G G G ? G G G G G G G G G G G G G G G A A A A A A ? ? ? A A A A A A A A A A A A A A A A A A A A A A A A A T T T T T T ? ? ? T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T ? ? ? T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T T ? ? ? T T T T T T T T T T T T T T T T T T T T T T T T T G G G G G G ? ? ? G G G G G G G G G G G G G G G G G G G G G G G G G A A A A A A ? ? ? A A A A A A A A A A A A A A A A A A A A A A A A A depending on the marker (Eaton et al. 2009). In comparison, the two C. niloticus clades exhibited 0.3% withinclade and 4% between-clade divergence across 5 kbp (Table S2). Preliminary morphometrics of C. niloticus from museum collections representing sites from Kenya and the Congo showing fixed, discrete and non-overlapping continuous character variation (R. Sadlier, unpublished data) also support this conclusion. That all mummy crocodiles from Thebes and Samoun exhibit the western haplotype suggests both lineages historically occurred in the lower Nile River (Fig. 1). These findings are consistent with early arguments of two Crocodylus species in Egypt, including historical accounts that ancient Egyptian priests were cognizant of two forms and selectively used the smaller, more tractable form in temples and ceremonies (Herodotus in Geoffroy Saint-Hilaire 1807). Analysis of museum speci- T T T T T T ? ? ? T T T T T T T T T T T T T T T T T T T T T T T T T A A A A A A ? ? ? A A A A A A A A A A A A A A A A A A A A A A A A A G G G G G G G G G G G G G ? ? ? ? G ? ? ? ? ? ? ? G G ? G ? ? ? ? ? C C C C C C C C C C C C C ? ? ? ? C ? ? ? ? ? ? ? C C ? C ? ? ? ? ? C C C C C C C C C C C C C ? ? ? ? C ? ? ? ? ? ? ? C C ? C ? ? ? ? ? . . . . . . . . . . . . . ? ? ? ? C ? ? ? ? ? ? ? . T ? T ? ? ? ? ? G G G G G G G G G G G G G ? ? ? ? G ? ? ? ? ? ? ? G G ? G ? ? ? ? ? A A A A A A A A A A A A A ? ? ? ? A ? ? ? ? ? ? ? A A ? A ? ? ? ? ? G G G G G G G G G G G G G ? ? ? ? G ? ? ? ? ? ? ? G G ? G ? ? ? ? ? C C C C C C C C C C C C C ? ? ? ? C ? ? ? ? ? ? ? C C ? C ? ? ? ? ? . . . G . G G G G . . . . ? ? ? ? G ? ? ? ? ? ? ? . G ? G ? ? ? ? ? G A A G G G G G G A A A G ? ? ? ? G ? ? ? ? ? ? ? G G ? G ? ? ? ? ? . . . . . . . . . . . . . ? ? ? ? . ? ? ? ? ? ? ? . . ? . ? ? ? ? ? C C C C C C C C C C C C C ? ? ? ? C ? ? ? ? ? ? ? C C ? C ? ? ? ? ? T T T T T T T T T T T T T ? ? ? ? T ? ? ? ? ? ? ? T T ? T ? ? ? ? ? C C C C C C C C C C C C C ? ? ? ? C ? ? ? ? ? ? ? C C ? C ? ? ? ? ? mens from more recent collections (Fig. 1b, Table 2) provides additional evidence that both lineages were present in the upper Nile in Sudan until as recently as the 1920s. Molecular assignment of the eight crocodile mummies to the western C. niloticus clade and Geoffroy Saint-Hilaire’s (1807) description of a mummified crocodile skull from the same cache as a separate species, C. suchus, provides support for ascribing the western C. niloticus lineage to this taxon. The description of C. suchus included the argument, disputed by Cuvier at the time (Cüvier 1807), that both C. niloticus and C. suchus were present in the Nile and that the range of C. suchus likely extended into the western Sahara (Geoffroy Saint-Hilaire 1807). Geoffroy Saint-Hilaire (1807) went so far as to argue that the distribution of both species likely overlapped in areas of ancient Lake Chad during geologic times. 2011 Blackwell Publishing Ltd C R Y P T I C A F R I C A N C R O C O D Y L U S S P E C I E S R E V E A L E D 13 Crocodylus biogeography and conservation Evidence for cryptic diversity within C. niloticus provides key information on the evolution and distribution of the genus Crocodylus. Fossils of Crocodylus checchiai in Libya (ca. 5–6 mya) (Brochu 2001, 2003) and the Gargano Crocodylus sp. (ca. 5–6 mya) of southeastern Italy (Delfino et al. 2007) provide evidence of dispersal and diversification within the genus in north Africa and the Mediterranean after the Miocene-Pliocene transition. In light of the fossil record (e.g. Brochu 2003) and estimated divergence dates based on our molecular data, our well-supported phylogenetic hypothesis of a paraphyletic C. niloticus bracketing New World congeners provides further support for the hypothesis that the global distribution of Crocodylus reflects geologically recent marine and transoceanic dispersal events (Brochu et al. 2007; Willis 2009; Meredith et al. 2011; Oaks 2011). These findings are consistent with hypothesized transoceanic marine dispersal in other taxa including geckos and parrots (e.g. de Queiroz 2005). While our divergence estimates are preliminary and partially based on uncertainties in the fossil record for C. niloticus in Africa (C. Brochu personal communication), the pattern of divergence we recovered is consistent with many well recognized aspects of African biogeography. The position of Congo Basin samples as basal within the western lineage, and preliminary divergence estimates dating to 8.13 mya for the most recent common ancestor of the western and eastern (including New World species) clades, suggest that the newly identified African Crocodylus lineage evolved in the interior of Central Africa during the late Miocene when the closing of the Tethys Sea brought about the climatic trend of increasing aridity we see on the continent today (Axelrod & Raven 1978; Coetzee 1993; Plana 2004). Increasing aridity resulted in the recession of forested areas and the advancement of savannah and woodlands with associated sandy shores necessary for nesting. The contemporary and historical presence of the western lineage at the northeastern margin of the Congo Basin, the Kidepo Valley in northeastern Uganda, and the Sangha River drainage in Central African Republic indicate that dispersal may have begun in a northerly direction and then along an east-west axis facilitated by drainage evolution (Goudie 2005; Drake et al. 2011). Further divergence in the western clade occurred throughout the mid to late Pleistocene (0.035–1.43 mya) likely owing to the gradual drying of the ‘green Sahara’ and subsequent population isolation (Drake et al. 2011). During this period, a series of alluvial fans and paleolakes effectively connected the Niger Delta (including the Senegal River) to the Nile basin largely through what was Mega Lake Chad and what is now the Sudd wetland in southern Sudan 2011 Blackwell Publishing Ltd (Drake et al. 2011). Relict populations and rock paintings indicate that crocodile populations were more abundant across northern Africa during wetter climatic periods (de Smet 1999; Shine et al. 2001; Drake et al. 2011). Within-lineage genetic structure provides more detailed understanding of connectivity across western Africa. One of the two clades recovered within the western lineage consists largely of Sahelian localities structured by the drying of paleodrainages towards the end of the Pleistocene (Drake et al. 2011) (Fig. S1). The other clade is composed of localities in the Upper Guinea Forest Basin countries (e.g. Nigeria, Ghana, Cote d’Ivoire), as well as coastal localities in Senegal and Gambia (Fig. S1). River drainages in this region run north to south draining into the Gulf of Guinea or Atlantic Ocean, and therefore have had little connection with paleodrainages of the Sahara. The observed phylogenetic structure also likely reflects drainage isolation with infrequent marine dispersal, a pattern seen in some coastal fishes (e.g. Falk et al. 2003; Agnese et al. 2006). Nile crocodiles are abundant in coastal lagoons in this region and are regularly observed in marine environments (Shirley et al. 2009; Fergusson 2010). Similarly, the eastern clade of C. niloticus is broken into two sister groups dating to around 3.274 mya with likely origins in the Nile valley. Prior analyses of eastern populations based on nuclear markers revealed substantial sub-structuring corresponding to major barriers to dispersal such as the Mozambique Channel (East Africa and Madagascar), and to river drainages in Kenya, Tanzania, Zimbabwe and South Africa (the Turkana, Ruaha, Zambezi and Limpopo river basins, respectively) (Hekkala et al. 2009). It is possible that the geographic structure exhibited by eastern C. niloticus may be related to patterns of natal philopatry-associated breeding and nesting behaviors (Hekkala et al. 2009). Similar patterns of sub-structuring by drainage basin have been observed in faunal assemblages found in East African forest remnants (Azeria et al. 2007). Our recovery of the eastern haplotype in two samples from western Central Africa (i.e. the Ogooué Basin—Gabon and Cameroon) likely reflects northward dispersal from coastal Angola and the Kunene River. The Cameroon Volcanic Line is a major biogeographic feature separating this region from coastal West Africa (Cantagrel et al. 1978; Lee et al. 1994; Meyers et al. 1998), and a similar pattern occurs in the Osteolaemus dwarf crocodiles (Eaton et al. 2009). On a continental scale, the cryptic east ⁄ west split found in our study of African Crocodylus parallels patterns of differentiation observed between sister taxa in several African faunal assemblages following the formation of the Rift Valley (de Menocal 2004; Moodley & Bruford 2007). However, the geographic distributions of 14 E . H E K K A L A E T A L . the ancestral and derived lineages (Fig. 1a, b) belie a history of greater sympatry in Africa. The occurrence of the derived lineage in historical specimens from Senegal suggests the possibility of either greater sympatry in western Africa in the past or a pattern of coastal dispersal by the Eastern lineage, though no contemporary specimens from West Africa to date, coastal or otherwise, support either argument (Fig. 1). Individuals from historical collections from the Sudanese Nile valley (1822–1922) and northeastern DRC (1911–1912) also possess both lineages. While further sampling in Sudan and NE DRC is needed to determine the extent of sympatry today, the presence of the western clade in the Kidepo Valley (Uganda) and anecdotal evidence of similar crocodile populations in Ethiopia suggests that the western clade is still distributed in this region though it may be restricted to marginal habitats. Previously, researchers using molecular data from paleontological collections have shown evidence that genetic diversity in wide ranging species has been lost over historical and paleoecological time periods (Ramakrishnan & Hadley 2009 and references therein). This growing field has been termed ‘phylochronology’ due to the emphasis on reconstructing patterns of genetic variation over time. Much of this work has focused on Holocene patterns of faunal turnover and range contractions in northern latitudes (Ramakrishnan & Hadley 2009; examples therein, e.g. Shapiro et al. 2004; Hofreiter et al. 2004). While these studies are invaluable in advancing understanding of the genetic consequences of environmental change, our study reveals a much more recent pattern of local extirpation with potentially global consequences for loss of crocodilian biodiversity. authenticating ancient DNA. The mummified crocodile hatchings, with the exception of the ‘pre-dynastic’ hatchling from PHM, proved to be an exceptional source for ancient DNA. The specimens came from dry, sealed, relatively cool burial chambers and are young (only 1 800–2 200 years old) in comparison to source materials used in many other ancient DNA studies (e.g. Hofreiter et al. 2004; Shapiro et al. 2004). Importantly, our samples have two additional, uniquely crocodilian advantages over samples comprised of mammalian bone and mummy tissue: nucleated red blood cells and a thick keratinized skin layer. Both of these attributes likely serve as sources and protective repositories for mtDNA. Our combined analyses of museum and contemporary specimens indicate that, as formulated, major national and international conservation agreements intended to promote sustainable harvest of Nile crocodiles may instead accelerate extirpation because quotas and translocation policies are based on erroneous taxonomy and assumptions of genetic homogeneity. This is particularly relevant in countries that harbour populations of both lineages and have long running harvest programs (e.g. Uganda) or are looking to initiate new harvest programs (e.g. Ethiopia and Sudan). The newly discovered evolutionary lineage of African Crocodylus is particularly vulnerable to extinction because of its relative rarity and restricted occurrence in countries where illegal harvest of skins, the bushmeat trade, and damage to wetlands are largely unregulated (Shirley et al. 2009). Taking precautionary measures, such as recognizing the ancestral lineage as C. suchus on the IUCN Red List and reviewing its status, could reduce further loss of at-risk populations. Conclusion This study emphasizes once again the utility of nontraditional archival specimens in contributing to our understanding of evolutionary relationships and biogeographic history (Leonard 2008). As techniques for accessing nucleic acids from archival materials become more readily and reliably available, materials found in ever more diverse repositories stand to provide greater insight into changes over time related to natural and anthropogenic processes. Our success in accessing DNA from archival materials adds to the growing body of work demonstrating the role of museum collections as banks of ‘ancient’ DNA that can be used to establish baseline genetic profiles against which change can be measured (Leonard 2008; Ramakrishnan & Hadley 2009 and references therein). However, use of archival materials is not without risk (Cooper & Poinar 2000). Many researchers examining genetic characteristics of paleomaterial have difficulty retrieving and Acknowledgements We thank the wildlife and CITES management authorities of Ghana, Cote d’Ivoire, Senegal, Gambia, Nigeria, Gabon, Republic of Congo, Egypt, Uganda, Kenya, Tanzania, Zimbabwe and Madagascar for permission to collect and export samples. Funding was provided by the University of Florida, Wildlife Conservation Society, The Sackler Institute for Conservation Genetics, Columbia University, Conservation, Food, and Health Foundation, Columbus Zoo, Idea Wild, Conservation Leadership Programme, St. Augustine Alligator Farm Zoological Park, Disney Wildlife Conservation Grant, US EPA Star Fellowship, and the Zoological Society of San Diego. We thank M.J. Eaton, R. Fergusson, T. Shine, W. Boehme, M.P.O. Dore, M. Klemens, A. Leslie, G. Garcia and the St. Augustine Alligator Farm Zoological Park for providing contemporary samples, and the California Academy of Sciences (J. Vindum), American Museum of Natural History, Field Museum, Royal Museum for Central Africa, Musée National du Histoire Naturelle (R. Bour), and Yale Peabody Museum (J. Gauthier) for permission to collect tissue from museum specimens. 2011 Blackwell Publishing Ltd C R Y P T I C A F R I C A N C R O C O D Y L U S S P E C I E S R E V E A L E D 15 Christopher Raxworthy and Salima Ikram provided insight into historical biogeography and animal mummies, respectively. We thank E. Derryberry for her assistance with BEAST analyses and three anonymous reviewers for suggested improvements to the work. Author contributions EH and MHS, who contributed equally to this work and are considered co-primary authors, designed the study, and conducted all lab work and phylogenetic analyses. EH collected samples from Madagascar and conducted all museum sampling and aDNA work. MHS collected all samples from Ghana, Cote-d’Ivoire, Senegal, Gambia, Uganda and Egypt. GA and RD, and JDA are the dissertation supervisors of EH and MHS, respectively, and contributed to the development of methods and provided funding support. JT was an avid conservationist and the MSc advisor for MHS. He contributed significantly to our understanding of the taxonomic history of Nile crocodiles, sampling strategy, design of fieldwork, and funding support. SC and MH conducted all karyotype analyses. KV contributed to the karyotype analysis of captive animals. MB contributed analytical expertise and lab support. Sampling protocols were reviewed by the University of Florida IACUC (#E-423). References Agnese J-F, Zentz F, Legros O, Sellos D (2006) Phylogenetic relationships and phylogeography of the Killifish species of the subgenus Chromaphyosemion (Radda, 1971) in West Africa, inferred from mitochondrial DNA sequences. Molecular Phylogenetics and Evolution, 40(2), 332–346. Anisimova M, Gascuel O (2006) Approximate likelihood ratio test for branches: a fast, accurate and powerful alternative. Systematic Biology, 55, 539–552. Axelrod DI, Raven PH (1978) Late cretaceous and tertiary vegetation history of Africa. In: Biogeography and Ecology of Southern Africa (ed. Werger JA), pp. 77–130. Junk, The Hague. Azeria ET, Sanmartin I, Ås S, Carlson A, Burgess N (2007) Biogeographic patterns of the East African coastal forest vertebrate fauna. Biodiversity and Conservation, 16(4), 883– 912. Baikie B (1857) On the species of Crocodilus inhabiting the rivers Kwóra and Bı́nuë (Niger and Tsadda) in Central Africa. Proceedings of Zoological Society of London, 25, 48–50. Boettger O (1877) Die Reptilien Und Amphibien von Madagascar. Christian Winter, Frankfurt. Bory de Saint-Vincent (1824) Dictionnaire classique d’histoire naturelle. Part 5. Rey & Gravier, Paris. Brazaitis P (1973) Identification of Living Crocodilians. Zoologica. Zoological Society, New York, pp. 59–100. Brochu CA (2000) Phylogenetic relationships and divergence timing of Crocodylus based on morphology and the fossil record. Copeia, 3, 657–673. Brochu CA (2001) Congruence between physiology, phylogenetics, and the fossil record on crocodylian historical biogeography. In: Crocodilian Biology and Evolution (eds Grigg G, Seebacher F, Franklin CE), pp. 9–28. Surrey Beatty and Sons, Sydney. 2011 Blackwell Publishing Ltd Brochu CA (2003) Phylogenetic approaches toward crocodilian history. Annual Review of Earth and Planetary Sciences, 31, 357–397. Brochu CA, Nieves-Rivera AM, Velez-Juarbe J, Daza-Vaca JD, Santos H (2007) Tertiary endemic crocodylians in the West Indies? Geobios, 40, 51–59. Cantagrel J, Jamond C, Lassere M (1978) Le magmatisme alcalin de la ligne du Cameroun au Tertiaire inferieur: données géochronologiques K ⁄ Ar. Comptes Rendus Sommaire de la Société Géologique de France, 6, 300–303. Coetzee JA (1993) African Flora since the Terminal Jurassic. In: Biological Relationships between Africa and South America (ed. Goldblatt P), pp. 37–61. Yale University Press, New Haven. Cooper A, Poinar HN (2000) Ancient DNA: do it right or not at all. Science, 289, 1139. Cretzschmar PJ (1826) Atlas zu der reise im nördlichen Afrika, von Eduard Rüppell. 1. Abth. Zoologie. Hrsg. von der Senkenbergischen Naturforschenden Gesellschaft. H. L. Brönner, Frankfurt am Main. Cüvier GL (1807) Sur les différentes espèces de crocodiles vivants et sur leurs caractères distinctifs. Annales du Muséum National d’Histoire Naturelle, 10, 8–66 + 1 pl. Davis JI, Nixon KC (1992) Populations, genetic variation, and the delimitation of phylogenetic species. Systematic Biology, 41, 421–435. Delfino M, Böhme M, Rook L (2007) First European evidence for transcontinental dispersal of Crocodylus (Late Neogene of Southern Italy). Zoological Journal of the Linnaean Society, 149, 293–307. Deraniyagala PEP (1948) Some scientific results of two visits to Africa. Spoila Zeylanica, 25(2), 1–42. Drake NA, Blench RM, Armitage SJ, Barlow CS, White KH (2011) Ancient watercourses and biogeography of the Sahara explain the peopling of the desert. Proceedings of the National Academy of Sciences, USA, 108(2), 458–462. Drummond AJ (2007) Beast: Bayesian evolutionary analysis by sampling trees. BMC Evolutionary Biology, 7, 214. Drummond AJ, Ho SY, Phillips MJ, Rambaut A (2006) Relaxed phylogenetics and dating with confidence. PLoS Biology, 4, e88. Eaton MJ, Martin A, Thorbjarnarson J, Amato G (2009) Specieslevel diversification of African dwarf crocodiles (Genus Osteolaemus): a geographic and phylogenetic perspective. Molecular Phylogenetics and Evolution, 50(3), 496–506. Falk TM, Teugels GG, Abban EK, Villwock W, Renwrantz L (2003) Phylogeographic patterns in populations of the blackchinned tilapia complex (Teleostei, Cichlidae) from coastal areas in West Africa: support for the refuge zone theory. Molecular Phylogenetics and Evolution, 27, 81–92. Fergusson RA (2010) Nile crocodile Crocodylus niloticus. In: Crocodiles. Status Survey and Conservation Action Plan, 3rd edn (eds Manolis SC, Stevenson C), pp. 84–89. Crocodile Specialist Group, Darwin. Friesen VL, Congdon BC, Kidd MG, Birt TP (1999) PCR primers for the amplification of five nuclear introns in vertebrates. Molecular Ecology, 8, 2147–2149. Fuchs K, Mertens R, Wermuth H (1974) Die Unterarten des Nilkrokodils Crocodylus niloticus. Salamandra, 10(3 ⁄ 4), 107– 114. Gatesy J, Amato GD (1992) Sequence similarity of 12S ribosomal segment of mitochondrial DNAs of gharial and false gharial. Copeia, 241–243. 16 E . H E K K A L A E T A L . Gatesy J, Amato G, Norell M, DeSalle R, Hayashi C (2003) Combined support for wholesale taxic atavism in gavialine crocodylians. Systematic Biology, 52(3), 403–422. Geoffroy Saint-Hilaire E (1807) Description de deux crocodiles qui existent dans le Nil, comparés au crocodile de SaintDomingue. Ann. Mus. Hist. Nat., 10, 67–86, 264 + 2 pl. Gilbert MTP, Bandelt H-J, Hofreiter M, Barnes I (2005) Assessing ancient DNA studies. Trends in Ecology & Evolution, 20(10), 541–544. Goldstein PZ, DeSalle R (2000) Phylogenetic species, nested hierarchies, and character fixation. Cladistics, 16, 364–384. Goudie AS (2005) The drainage of Africa since the Cretaceous. Geomorphology, 67(3–4), 437–456. Grandidier A (1872) Description de quelques reptiles noveaux decouverts a Madagascar en 1870. Annual Science Nature Paris, series 5, 15(20), 6–11. Griffith E, Pidgeon E (1831) The Class Reptilia. The Animal Kingdom Arranged in Conformity With Its Organization, Vol. 9. Whittaker, Treacher, and Co., London, 97–201. Guindon S, Gascuel O (2003) A simple, fast, and accurate algorithm to estimate large phylogenies by maximum likelihood. Systematic Biology, 52, 696–704. Hekkala ER, Amato G, Desalle R, Blum MJ (2009) Molecular assessment of population differentiation and individual assignment potential of Nile crocodile (Crocodylus niloticus) populations. Conservation Genetics, 11(4), 1435–1443. Hess PN, de Moraes CA, Russo M (2007) An empirical test of the midpoint rooting method. Biological Journal of the Linnaean Society, 92, 669–674. Hewitt J (1937) A Guide to the Vertebrate Fauna of the Eastern Cape Province, South Africa. Part II: Reptiles, Amphibians and Freshwater Fishes. Albany Museum, Grahamstown, South Africa. Hofreiter M, Serre D, Rohland N et al. (2004) Lack of phylogeography in European mammals before the last glaciation. Proceedings of the National Academy of Sciences, USA, 101(35), 12963–12968. Hutton JM (2000) Who knows best? Controversy over unilateral stricter domestic measures. In: Endangered Species, Threatened Convention. The Past, Present and Future of CITES (eds Hutton JM, Dickson B), pp. 57–66. Earthscan, London. King FW, Burke RL (eds) (1989) Crocodilian, Tuatara, and Turtle Species of the World: A Taxonomic and Geographic Reference. Association of Systematics Collection, Washington D.C. ISBN: 0-942924-15-0. Kluge AG (1998) Total evidence or taxonomic congruence: cladistics or consensus classification. Cladistics, 14, 151–158. Kumamoto AT, Charter SJ, Houck ML, Frahm M (1996) Chromosomes of Damaliscus (Artiodactyla, Bovidae): simple and complex centric fusion rearrangements. Chromosome Research, 4, 614–621. Larkin MA et al. (2007) Clustal W and Clustal X version 2.0. Bioinformatics, 23, 2947–2948. Laurenti JN (1768) Specimen Medicum, Exhibens Synopsis Reptilium. Vienna. Lee D-C, Halliday AN, Fitton JG, Poli G (1994) Isotopic variations with distance and time in the volcanic islands of the Cameroon line: evidence for a mantel plume origin. Earth and Planetary Science Letters, 123, 119–138. Leonard JA (2008) Ancient DNA applications for wildlife conservation. Molecular Ecology, 17, 4186–4196. doi: 10.1111/ j.1365-294X.2008.03891.x Maddison WP (1997) Gene trees in species trees. Systematic Biology, 46, 523–536. May RM (1990) Taxonomy as destiny. Nature, 347, 129–130. McAliley LR et al. (2006) Are crocodiles really monophyletic? Evidence for subdivisions from sequence and morphological data. Molecular Phylogenetics and Evolution, 39, 16–32. de Menocal PB (2004) African climate change and faunal evolution during the Pliocene-Pleistocene. Earth and Plant Science Letters Frontiers, 6976, 1–2. Meredith RW, Hekkala E, Amato G, Gatesy J (2011) A phylogenetic hypothesis for Crocodylus (Crocodylia) based on mitochondrial DNA: evidence for a trans-Atlantic voyage from Africa to the New World. Molecular Phylogenetics and Evolution, 60, 183–191. Meyers JB, Rosenthal BR, Harrison GA, Ding ZD (1998) Deepimaging seismic and gravity results from offshore Cameroon Volcanic Line, and speculation of African hotlines. Tectonophysics, 284, 31–63. Miller WE (1980) The Late Pliocene Las Tunas Local Fauna from Southernmost Baja California, Mexcio. Journal of Paleontology, 54(4), 762–805. Moodley Y, Bruford MW (2007) Molecular biogeography: towards an integrated framework for conserving pan-African biodiversity. PLoS ONE, 2, e454. Moritz C (1994) Defining ‘Evolutionarily Significant Units’ for conservation. Trends in Ecology and Evolution, 9, 373–375. Nylander JA, Ronquist F, Huelsenbeck JP, Nieves-Aldrey JL (2004) Bayesian phylogenetic analysis of combined data. Systematic Biology, 53, 47–67. Oaks JR (2011) A time calibrated species tree of Crocodylia reveals a recent radiation of the true crocodiles. Evolution, (in press). doi: 10.1111/j.1558-5646.2011.01373.x Paabo S, Poinar H, Serre D et al. (2004) Genetic analyses from ancient DNA. Annual Review of Genetics, 38, 645–679. Plana V (2004) Mechanisms and tempo of evolution in the African Guinea-Congolian rainforest. Philosophical Transactions of the Royal Society of London Series B: Biology, 359, 1585–1594. Posada J (2008) jModelTest: phylogenetic model averaging. Molecular Biology and Evolution, 25, 1253–1256. de Queiroz A (2005) The resurrection of oceanic dispersal in historical biogeography. Trends in Ecology & Evolution, 20(2), 68–73. Ramakrishnan U, Hadley EA (2009) Using phylochronology to reveal cryptic population histories: review and synthesis of 29 ancient DNA studies. Molecular Ecology, 18, 1310–1330. Rambaut A (2006) FigTree: Tree Figure Drawing Tool, v.1.0. Institute of Evolutionary Biology, University of Edinburgh. http://tree.bio.ed.ac.uk/software/figtree/. Rambaut A, Drummond AJ (2005) Tracer v1.3: MCMC Trace Analysis Tool. Institute of Evolutionary Biology, University of Edinburgh. http://tree.bio.ed.ac.uk/software/tracer/ Ray DA, Densmore L (2002) The crocodilian mitochondrial control region: general structure, conserved sequences and evolutionary implications. Journal of Experimental Zoology, 294, 334–345. 2011 Blackwell Publishing Ltd C R Y P T I C A F R I C A N C R O C O D Y L U S S P E C I E S R E V E A L E D 17 Ronquist F, Huelsenbeck JP (2003) MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics, 19, 1572–1574. Ross JP (ed) (1998) Status Survey and Conservation Action Plan: Revised Action Plan for Crocodiles. http://iucncsg.org/ph1/ modules/Publications/action_plan1998/plan1998a.htm 1998. Sarkar IN, Planet PJ, DeSalle R (2008) CAOS software for use in character-based DNA barcoding. Molecular Ecology Resources, 8(6), 1256–1259. Schmidt H (1885) Gedächtnisrede auf Dr. Eduard Rüppell. Ber. Senckenb. Naturf. Ges., 95–160 + 2 plates. Schmitz A et al. (2003) Molecular evidence for species level divergence in the Nile crocodile (Crocodylus niloticus). Comptes Rendus Palevol, 2, 703. Seutin G, Lang BF, Mindell DP, Morais R (1994) Evolution of the WANCY region in amniote mitochondrial DNA. Molecular Biology and Evolution, 11, 329–340. Shapiro B, Drummond AJ, Rambaut A et al. (2004) Rise and fall of the Beringian steppe bison. Science, 306, 1561–1565. Shedlock A, Haygood M, Pietsch T, Bentzen P (1997) Enhanced DNA extraction and PCR amplification of mitochondrial genes from formalin-fixed museum specimens. BioTechniques, 22, 394–400. Shine T, Böhme W, Nickel H, Thies DFG, Wilms T (2001) Rediscovery of relict populations of the Nile crocodile Crocodylus niloticus in south-east Mauritania, with observations on their natural history. Oryx, 35(3), 260–262. Shirley MH, Oduro W, Yaokokore-Beibro H (2009) Conservation Status of Crocodiles in Ghana and Coted’Ivoire, West Africa. Oryx, 43, 136–145. de Smet K (1999) Status of the Nile crocodile in the Sahara desert. Hydrobiologia, 391, 81–86. Stejneger L (1933) Crocodilian Nomenclature. Copeia, 3, 117– 120. Swofford DL (2002) PAUP* Phylogenetic Analysis Using Parsimony (*and Other Methods). V.4. Sinauer Associates, Sunderland. Tamura K, Kumar S (2002) Evolutionary distance estimation under heterogeneous substitution pattern among lineages. Molecular Biology and Evolution, 19, 1727–1736. Tamura K, Nei M, Kumar S (2004) Prospects for inferring very large phylogenies by using the neighbor-joining method. Proceedings of the National Academy of Sciences, USA, 101, 11030–11035. Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: molecular evolutionary genetics analysis (MEGA) software version 4.0. Molecular Biology and Evolution, 24, 1596–1599. Wermuth H, Mertens R (1977) Liste der rezenten Amphibien und Reptilien. Testudines, Crocodylia, Rhynchocephalia. Das Tierreich, 100, 1–174. White P, Densmore L (2001) DNA sequence alignments and data analysis methods: their effect on the recovery of crocodylian relationships. In: Crocodilian Biology and Evolution Surrey Beatty and Sons Chipping Norton, NSW (eds Grigg G, Seebacher F, Franklin F), pp. 29–37. 2011 Blackwell Publishing Ltd Willerslev E, Cooper A (2005) Ancient DNA. Proceedings of the Royal Society B, 272, 3–16. Willis RE (2009) Transthyretin gene (TTR) intron 1 elucidates crocodylian phylogenetic relationships. Molecular Phylogenetics and Evolution, 53, 1049–1054. M.H.S.’s research utilizes multiple inferential tools to elucidate population-level processes over different temporal and spatial scales to facilitate the conservation of wildlife in Africa and elsewhere. He is particularly interested in the interaction between historic, landscape features and contemporary human pressures in structuring wildlife populations. Data accessibility DNA sequences: DRYAD entry (datadryad.org; doi:10.5061/ dryad.s1m9h) Supporting information Additional supporting information may be found in the online version of this article. Table S1 Gene regions and protocols used for amplification of mtDNA and nuclear introns for Crocodylus niloticus and affiliated specimens used in the study Table S2 Estimated Molecular Divergence. Mean distance estimates with S.E. for the full, concatenated dataset (below diagonal) and mtDNA-only dataset (above diagonal). Values in the diagonal are intragroup mean distance estimates with S.E. for the full, concatenated dataset (left) and mtDNA-only dataset (right) Table S3 All mummy specimens examined for this study. Locality and date information is from museum accession notes unless otherwise noted Fig. S1 Estimated divergence dates for the two Crocodylus niloticus clades under a relaxed clock model as implemented in BEAST v.4.3. The displayed estimates for mean divergence date and 95% confidence intervals are based on the full dataset partitioned by coding region with subsequent codon position partitioning. Fig. S2 Phylogenetic tree resulting from maximum likelihood analysis of concatenated 12s and d-loop short fragments for contemporary and archival specimens. Mummy specimens have blue terminal labels. Please note: Wiley-Blackwell are not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing material) should be directed to the corresponding author for the article. REP CONGO_4 SAAF_1 DEM REP CONGO 2.45 UGANDA_1 GAMBIA_1 1.43 BURKINA FASO MAURITANIA_2 NIGERIA 1.09 IVORY COAST_2 GHANA_1 0.78 8.13 UGANDA_2 GAMBIA_2 GAMBIA_3 SENEGAL 4.10 1.67 C. moreletii C. rhombifer C. acutus 2.99 C. intermedius EGYPT_1 EGYPT_2 EGYPT_3 5.72 EGYPT_4 UGANDA_5 UGANDA_6 UGANDA_3 3.27 SAAF_2 GABON_1 11.50 SOUTH AFRICA 2.07 KENYA_1 KENYA_3 KENYA_2 TANZANIA_1 1.24 TANZANIA_2 ZIMBABWE_3 MALAWI 29.16 MADAGASCAR_1 MADAGASCAR_2 MADAGASCAR_3 MADAGASCAR_4 C. porosus 8.04 18.00 C. siamensis O.tetraspis M. cataphractus A. mississippiensis O.tetraspis M. cataphractus C. siamensis C. porosus SENEGAL_1934 SUDAN_MELUT_1922 SUDAN_WNA_1922 SUDAN_WNB_1922 MUMMY_HAUTE MUMMY_THEBES_B IVORY COAST_1885 DEM REP CONGO_1924 SENEGAL_1825 CHAD GAMBIA_3 SENEGAL GAMBIA_2 UGANDA_1 REP CONGO_3 MAURITANIA_1 REP CONGO_1 SENEGAL_1824 BENIN NIGERIA IVORY COAST SAAF_1 GHANA_1 REP CONGO_4 UGANDA_2 DEM REP CONGO MAURITANIA_2 BURKINA FASO GAMBIA_1 MUMMY_THEBES_C REP CONGO_2 ZIMBABWE_1911 REP CONGO_1886 CENTRAL AFR REP MUMMY_SAMOUN_A MUMMY_SAMOUN_B MUMMY_SAMOUN_C MUMMY_THEBES_A C. intermedius C. acutus C. moreletii C. rhombifer EGYPT_1 EGYPT_2 EGYPT_3 EGYPT_4 SUDAN_WNC_1922 UGANDA_5 ZIMBABWE_2 ZIMBABWE_1 EGYPT_5 MADAGASCAR_A_1931 SUDAN MADAGASCAR_B_1931 SENEGAL_1768 EGYPT_1822 KENYA_1960 SENEGAL_1803 SAAF_1 GABON_1 ZIMBABWE_1912 UGANDA_6 UGANDA_3 KENYA_1919 KENYA_1 KENYA_3 MADAGASCAR_C_1931 KENYA_2 BOTSWANA_1967 MALAWI ZIMBABWE_3 SOUTH AFRICA TANZANIA_1 TANZANIA_2 MADAGASCAR_2 SUDAN_WNE_1922 SUDAN_WND_1922 SUDAN_UN_1922 CAMEROON_1966 TANZANIA_1972 MADAGASCAR_1 MADAGASCAR_4 MADAGASCAR_1885 MADAGASCAR_3 Table S1 PCR Reaction Cocktail Gene 12S 12s (short) 16S Control Region/dloop d-dloop short ND4 Wancy Rag-1 Trop OD S6 Vol. Reaction Buffer µL 15 25 25 15 25 25 15 15 20 20 15 5X mM 1 1.5 Illustra puretaq beads Illustra puretaq beads 1 1.5 Illustra puretaq beads Illustra puretaq beads 1 1.75 1 1.5 0.85 1.5 0.9 1.5 0.9 1.5 MgCl2 PCR Cycle Conditions dNTP's Primer Taq mM 0.2 µM 0.5 U/µM 0.03 0.2 0.5 1 0.03 0.2 0.2 0.2 0.2 0.2 0.5 0.5 0.5 0.5 0.5 0.03 0.03 0.03 0.03 0.03 Extended Denature Minutes 4:00 5:00 5:00 4:00 4:00 5:00 4:00 4:00 4:00 4:00 4:00 Denature Anneal Extension Extended Extension # ͦ C Minutes ͦC Minutes ͦC Minutes ͦC Minutes ͦC # 94 1:00 94 1:00 52 1:30 74 4:00 72 35 94 1:00 94 1:00 52 1:30 72 4:00 72 35 94 1:00 94 1:00 52 1:30 72 4:00 72 33 94 1:00 94 1:00 54 1:30 72 4:00 72 35 94 1:00 94 1:00 54 1:30 72 4:00 72 35 94 1:00 94 1:00 52 1:30 72 4:00 72 33 94 1:00 94 1:00 55 1:30 72 4:00 72 35 94 1:00 94 1:00 56 1:30 72 4:00 72 35 94 1:00 94 1:15 56 1:30 76 4:00 74 35 94 1:00 94 1:00 54 1:30 74 4:00 72 35 94 1:00 94 1:00 60 1:30 74 4:00 72 35 Table S2 Eastern C. niloticus Western C. niloticus New World Asia Mecistops cataphractus Osteolaemus tetraspis Alligator mississippiensis Eastern C. niloticus Western C. niloticus New World Asia M. cataphractus O. tetraspis A. mississippiensis 0.003 0.007 0.045 0.032 0.066 0.125 0.166 0.484 ±0.0008 ±0.00169 ±0.00921 ±0.00647 ±0.01247 ±0.02228 ±0.03081 ±0.14319 0.044 0.004 0.007 0.057 0.065 0.123 0.174 0.506 ±0.01136 ±0.00094 0.002 ±0.01158 ±0.01239 ±0.02240 ±0.03332 ±0.16007 0.071 0.135 0.178 0.514 ±0.01329 ±0.02426 ±0.03282 ±15967 0.138 0.188 0.492 ±0.02463 ±0.03480 ±0.15171 0.155 0.513 ±0.02876 ±0.15830 0.039 0.056 ±0.00892 ±0.01325 ±0.00463 ±0.00577 0.075 0.067 0.076 ±0.01670 ±0.01603 ±0.01680 ±0.0149 ±0.01374 0.144 0.144 0.140 0.153 ±0.03427 ±0.03492 ±0.03296 ±0.03589 0.175 0.162 0.158 0.197 0.159 ±0.04625 0.042 ±0.04152 ±0.05273 ±0.03966 0.293 0.332 0.332 0.396 0.338 0.316 0.086 ±0.11862 ±0.10341 ±0.14893 ±0.10481 ±0.09330 0.023 0.031 0.076 0.077 N/A N/A 0.471 ±0.13390 N/A Museum MNHN MNHN MNHN MNHN MNHN MNHN MNHN Specimen Number 1986_1475 1986_1478 1986_1480 1986_1471 1986_1473 1986_1479 1886_445 PHM PHM PHM BM BM BM BM BM BM Upenn Upenn Upenn Upenn Upenn 620101 55121 514 35734 35726 35747 35751 6837 6847 E521 2965563 E2832 L12112 L12113 Terminal Label MUMMY_SAMOUN_A MUMMY_SAMOUN_B MUMMY_SAMOUN_C MUMMY_THEBES_A MUMMY_THEBES_B MUMMY_THEBES_C MUMMY_HAUTE N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A Specimen Name mummySamA mummySamB mummySamC mummyThebA mummyThebB mummyThebC MummyHaute PHM620101 PHM55121 PHM514 BM35734 BM35726 BM35747 BM35751 BM6837 BM6847 UpennE521 Upenn2965563 UpennE2832 UpennL12112 UpennL12113 Site Number 8 8 8 7 7 7 7 N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A N/A MNHN= Musee National d'Histoire Naturelle, PHM=Phoebe Heart Museum UCBerkeley, BM=British Museum, Upenn=Penn Museum * estimated dates as per S. Ikram Cairo Museum Locality Mummy - Grottes de Samoun Mummy - Grottes de Samoun Mummy - Grottes de Samoun Mummy - Grottes de Thebes Mummy - Grottes de Thebes Mummy - Grottes de Thebes Mummy, Haute Egypt Country Egypt Egypt Egypt Egypt Egypt Egypt Egypt Collector Gervais Gervais Pariset Cailloud - collected 1820s Cailloud - collected 1820s Cailloud - collected 1820s V. Schoelcher Mummy unknown Mummy unknown Mummy unknown Mummy Manfalut Mummy unknown Mummy Manfalut Mummy Manfalut Mummy Manfalut Mummy Manfalut Mummy unknown Mummy-Dindereh Mummy-Tel El Yehudiyeh Mummy-Maabdah (Samoun) Mummy-Thebes? Egypt Egypt Egypt Egypt Egypt Egypt Egypt Egypt Egypt Egypt Egypt Egypt Egypt Egypt Unknown Unknown Unknown E.J. Andrews Unknown Unknown Unknown E.J. Andrews E.J. Andrews Unknown Cox Expedition 1918 Flinders Petrie Unknown G.R. Glidden 1848 Date Collected 200BC-200AD* 200BC-200AD* 200BC-200AD* 200BC-200AD* 200BC-200AD* 200BC-200AD* 200BC-200AD* Haplotype W W W W W W W pre-dynastic pre-dynastic pre-dynastic Roman pre-dynastic pre-dynastic pre-dynastic Roman Roman ND ND ND Late period Late period ND ND ND ND ND ND ND ND ND ND ND ND ND ND

RELATED PAPERS

RELATED TOPICS

Log In

An ancient icon reveals new mysteries: mummy DNA resurrects a cryptic species within the Nile crocodile

An ancient icon reveals new mysteries: mummy DNA resurrects a cryptic species within the Nile crocodile

Related Papers

RELATED PAPERS

RELATED TOPICS